Neuroinflammation Bacteria

A reader asked me if we knew which bacteria causes neuroinflammation. This is what I could find documented (often in association with specific medical conditions that have neuroinflammation)

Nutrients 11 02714 g003 550

Undigested Food and Gut Microbiota May Cooperate in the Pathogenesis of Neuroinflammatory Diseases: A Matter of Barriers and a Proposal on the Origin of Organ Specificity. [2019]
  • ” increased in abundance in mice with PD microbiomes include Proteus sp., Bilophila sp., and Roseburia sp., with a concomitant loss of members of families Lachnospiraceae, Rikenellaceae, and Peptostreptococcaceae, as well as Butyricicoccus sp. (Figure 6E). Interestingly, some taxa are altered only in ASO (Different DNA) animals (e.g. Proteus sp., Bilophila sp., and Lachnospiraceae), while others display significant changes independent of mouse genotype (e.g. Rosburia sp., Rikenellaceae, and Enterococcus sp.) … depletions in members of family Lachnospiraceae and Ruminococceae in recipient mice, a notable finding as these same genera are significantly reduced in fecal samples directly from PD patients  ” [2017]
  • ”  the relative abundance of 89 taxa differed significantly between groups with the majority of these changes accounted for by the Clostridiales order and within that, Lachnospiraceae and Ruminococcaceae. These taxa showed a range of macronutrient specific correlations with place memory. In addition, Distance based Linear Models found relationships between memory, inflammation-related hippocampal genes and the gut microbiota. ” The effect of short-term exposure to energy-matched diets enriched in fat or sugar on memory, gut microbiota and markers of brain inflammation and plasticity. [2016]
  •  Finally, alteration of gut microbiota (i.e., an increase in Bacteroidetes phylum and in Prevotellaceae family at the end of the treatment and a decrease in Ruminococcaceae family, Oscillospira and Lachnospira genus at the end of the withdrawal period) was detected. In conclusion, finasteride treatment in male rats has long term effects on depressive-like behavior, hippocampal neurogenesis and neuroinflammation and gut microbiota composition. [2019]
  • the inflammation related family Erysipelotrichaceae was more abundant  [2018]

Bottom Line

Low levels of Ruminococcaceae and Lachnospiraceae is the most common feature.

These two are also associated with:

Misc Notes:

  • Sesame seed decreases [2019]

The taxonomy nightmare before Christmas…

See also:

This post is intended to educate people more on the technical aspects of the microbiome. I am not talking about taking 4 samples from one stool and sending it to 4 different testing company. I am talking about one sample sent to one testing company which then provided their analysis and a FASTQ file. The raw data.

What is a FASTQ file (besides being megabytes big)? It is the DNA (technically the RNA) of the bacteria in the stool. It looks like this (using the 4 letters that DNA has):

CCGGACTACACGGGTTTCTAATCCTGTTTGATACCCACTCTTTCGAGCATCAGTGTCAGTTGCAGTCCAGTGAGCAGCCTTCGCAATCGGAGTTCATCGTTATATCTAAGCATTTCACCGCTACACAACGAATTCCGCACACCTCTA

The file that I am using as text would be around 16 megabytes. This data comes from a lab machine. The company then processes it through their software to match up sequences to bacteria.

In this post, I am using the FASTQ from uBiome and getting reports on the bacteria from:

  • ubiome
  • thryve inside
  • biomesight
  • sequentia biotech.

Naively, one would expect almost identical results. What I got is shown in detail below. At a high level we had the following taxa counts reported

  • ubiome – 253
  • thryve inside – 632
  • biomesight – 558
  • sequentia biotech 366

I did a more technical post on my other blog. From some providers, a taxonomy may be 40% on another 2% or even none… ugly!

Standards seekers put the human microbiome in their sights, 2019

Here, we compare the performance of 14 differential abundance testing methods on 38 16S rRNA gene datasets with two sample groups. We test for differences in amplicon sequence variants and operational taxonomic units (ASVs) between these groups. Our findings confirm that these tools identified drastically different numbers and sets of significant ASVs, and that results depend on data pre-processing.

Microbiome differential abundance methods produce different results across 38 datasets [2022]

New 2026 Study in Nature

A visual demonstation using 2 16s tests and a shotgun test

The headaches!

Number One Issue: You cannot, repeat cannot, compare a taxonomy report from one lab with another. EVER!

  • I have 8 uBiome reports and 2 Thryve reports. I can compare the uBiome to each other and the Thryve to each other. I can never mix their direct taxonomy reports !

Number Two Issue: If I wish to compare different lab reports, I MUST obtain the FastQ files from each lab and process them thru the same provider. The FastQ files are the raw data! For me, I prefer to push them through multiple providers which means that the 10 reports suddenly become 40 or 50 different reports in my site.

For more details with examples, see The problem with “official” ranges from labs

Examples

Only one lab reports Ehrlichia ovina….. why?? The values for other bacteria are all over the place from different labs

My Headaches

I have revised my site to show data by specific provider (while keeping the across all provider data still available). A lot of pages to revise and test.

A video walking through issues:
https://www.youtube.com/watch?v=iN7dbtFsOXE

Some additional readings:

The CCI thing and ME/CFS

A reader has asked me about CCI because of this post on Facebook

CCI – Craniocervical instability – Read me-pedia.org article on it too

Back to strict scientific method…

If I said, “ME/CFS – has blood diagnose, have not found a single patient whose does not have blood, not a single one” people would look at me a little strange. Why? Because it is known that everyone has blood.

What is needed is simple and needs some numbers done in a proper study:

  • Is this specific for CFS or common across many conditions?
    • What percentage of people without CFS has CCI
    • What percentage of people with IBS but without CFS has CCI
    • What percentage of people with FM but without CFS has CCI
    • What percentage of people with Alzheimer’s have CCI
    • What percentage of people with Physical Brain Trauma have CCI
  • What percentage of people is recommended treatment 100% effective for?
    • Spontaneous remission is well know in ME/CFS with people assigning their last attempt to be the cause. It’s typical human association

Reading the up to date, with extensive documentation on ME-Pedia article on CCI I am left with the impression that it will be found in many patients and that this would be implied by the name of ME which means myalgic encephalomyelitis. Encephalomyelitis is inflammation of the brain and spinal cord. This was the original name and accurately describes typical findings of MRI and SPECT scans (see this post). ”

Inflammation causes compression…

My take is that the inflammation is primarily caused by metabolites from the microbiome. I say primarily, because parts of the brain may react to those metabolites and proceed to dump other signalling chemicals/metabolites into the body. A feedback loop. A feedback loop with a viable simple point of interruption — the gut microbiome.

Bottom Line

Remission from CCI is theoretically possible and has probably happens. Some chiropractors will likely claim that appropriate adjustment may be sufficient. A surgery impacts the spinal cord and may easily interrupt some feedback mechanisms. Below is the results of people who have had CCI

https://www.ncbi.nlm.nih.gov/pmc/articles/PMC6821667/
Published 2019, https://www.ncbi.nlm.nih.gov/pmc/articles/PMC6821667/

The problem is that there is not a single multi-patients study on ME/CFS patients have been published on it. Looking at the multi-patient study with five years of follow up, show above- yes! It can result in improvement: totally expected because of its impact on the inflammation of the spinal cord. As a universal (or even common) method to full remission — the evidence does not support it.

Some taxa now have Modifiers

These were determined by the “Friend-or-Foe” analysis. This was done by examining which pairs of bacteria increase or decrease with a strong relationship (correlation). If something like Walnuts causes my friends to increase, then it will likely cause me to increase as a side effect. If Melatonin causes my friends to decrease, then it will likely cause me to decrease.

A video showing how we get this data

These were generated only for taxa that had:

  • No direct citations
  • No direct citations for the parents (only done when there are no direct citations)
  • No direct citations for the descendents (only done when there are no direct citations)

In short, no information. The logic being used is simple, we infer only when we have no data. Only the top 10 influences are used.

In terms of displays:


Inferred will usually be the only item listed for those below

Items added

class Epsilonproteobacteria
class Lentisphaeria
class Methanobacteria
class Synergistia
family Eggerthellaceae
family Peptoniphilaceae
genus Finegoldia
genus Gelria
genus Gemella
genus Murdochiella
genus Peptoniphilus
no_rank Bacillales Family XI. Incertae Sedis
no_rank Bacillales incertae sedis
no_rank Chlamydiae/Verrucomicrobia group
order Acidaminococcales
order Bifidobacteriales
order Coriobacteriales
order Corynebacteriales
order Eggerthellales
order Fibrobacterales
order Flavobacteriales
order Fusobacteriales
order Propionibacteriales
order Synergistales
order Tissierellales
order Veillonellales
order Victivallales
species Actinomyces odontolyticus
species Finegoldia magna
species Murdochiella sp. S9 PR-10
species Peptoniphilus lacrimalis
species Peptoniphilus sp. 1-14
species Peptoniphilus sp. 2002-38328
species Peptoniphilus sp. gpac018A
species Varibaculum sp. CCUG 45114
subclass Actinobacteridae
suborder Actinomycineae
suborder Coriobacterineae

ME/CFS improved on antibiotics

A reader wrote to me

Hi Ken,
So I had my first sinus / ear infection in years and was put on Augmentin. Within 24 hours, I was feeling better than I have in years. That has continued somewhat the whole course of treatment, though I only have a few days left.
I think it’s possible to use your site to see what a specific antibiotic might be doing to the microbiome? Can you do a walkthrough? Maybe I can replicate the effect Augmentin is having with supplements, probiotics and food since my last microbiome test is over a year old now.
Always striving…

This type of email, describing feeling better on some antibiotics, I have seen many, many times from people with ME/CFS. The problem is physicians will prescribe antibiotics for other issues, for example Acne, but not for severely life-changing conditions like ME/CFS.

I have one more question, for example if I want to replace the fluoroquinolones antibiotic class with a herb or herbs, can I use your website to find a “replacement” that would have a similar impact on the microbiome ? If yes, how would I do that ?

From a different reader in this morning’s emails. With a specific microbiome, it can be inferred – but in terms of a generic equivalent … antibiotics impact too many things to get a reasonable replacement of herbs and spices.

This reader asked something which was an elegant request, “replicate the effects of the antibiotics”. After some experiments, I discovered that it was possible and just finished creating a page.

  • A microbiome (16s) is needed before the antibiotics
  • The name of the antibiotic

Verbal Description of the Steps

  1. Log on to the site, you will see a new button [Antibiotics Helped]

A new page appears, type in the name of the antibiotic, perhaps with ‘%’ around it to do a general search

Note: This can be done for ANYTHING in our modifier database that made a major improvement.

You may get multiple items, usually brand names for the same thing,

Check the item desired (only one is allowed), THEN pick the microbiome sample you used. Click the button if needed.

A new page will appear. This consists of the bacteria impacted by this antibiotic and what you had. The person may have 500 taxa, the antibiotic may have 60 taxa, what is in common (the “intersection”) may be just 30 taxa. The items that are in common are what is shown.

Inspect the candidates, and put a check box by the ones you wish to include. Then click add to hand picked taxa. This will send you back to the samples page. On this page you will see a golden line of buttons appear.

Click View to see what was added:

Return, and then try the golden suggestions buttons. I first did it with just herbs and antibiotics to see if there are alternative antibiotics, and more important, where did my antibiotic show up in the rankings

Augmentin is the trade name for amoxicillin

That’s it. A video with more discussion is below.

A walkthru with comments

ADDENDUM 1

A reader pointed out that this can be used for screening / testing for likely side-effects on the microbiome BEFORE taking! An example is shown below


ADDENDUM 2

I decided to make available under the DEMO login, my microbiome from early in my ME/CFS relapse. The microbiome may not apply to you — but if you are looking for herbs, spices etc for fluoroquinolones and minocycline, Zithromax, etc and DO NOT have a microbiome sample, then it is likely better than no information. From my experience with various antibiotics, some work very well and others “so-so”

If anyone else wishes to share one of their samples for a specific condition, feel free to email me. I will change the email to “demo” and update the person information in the database to preserve your privacy.